The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. SV40 / hFerH / mEF1 promoter (Ubiquitous) in pDRIVE expression plasmid. To identify new sequence elements in the promoter that affect splicing patterns of pre-mRNAs, we analyzed effects of different promoters on alternative splicing of model reporter genes. Plays a role in viral genome replication by driving entry of quiescent cells into the cell cycle and by autoregulating the synthesis of viral early mRNA. We have previously shown that the nuclear import of plasmid DNA is sequence specific: plasmids carrying portions of the SV40 promoter/enhancer region are transported into the nucleus while similar. Simian virus 40 in humans | Infectious Agents and Cancer. Activity of simian virus 40 late promoter elements in the. SV40 early region promoter (Psv) | Physics Forums Addgene does not distribute primers. A lymphocyte-specific cellular enhancer is located. SV40 pAn pCpGrich: 5' primer GCAGGAAAAGTGGCACTATG Forward EF1 5'UTR 3' primer AACTTGTTTATTGCAGCTT Reverse SV40 pAn pFUSE-CLIg / pFUSE-CHIg: 5' primer TGCTTGCTCAACTCTACGTC Forward HTLV 5'UTR pFUSE-Fc / pINFUSE (human IgG1, IgG2, IgG3, IgG4 and rabbit IgG) 5' primer TGCTTGCTCAACTCTACGTC Forward Figure 4. It also contains the CAT gene for added vector. The simian virus 40 (SV40) enhancer element is constituted of two domains which contain sequences important for late transcription (M. ASequenceMotifintheSimianVirus40(SV40)Earl圜ore. The pGL2-Control Vector contains the SV40 promoter and enhancer sequences, resulting in strong luc expression in many types of mammalian cells.
#Sv40 poly a snapgene pdf#
PDF pEGFP-N1 While the SV40 sequence is a terminator sequence that signals the end of a. Inserting one copy or 64 copies of 3F3R in upstream of Alu tandem sequence caused the production of lower-molecular-mass GFP RNA.The Influence of SV40 polyA on Gene Expression of. Nevertheless, 2F2R located upstream of Alu tandem sequence can induce transcription termination. 2F2R can support transcription elongation when 2F2R is located upstream of other 2F2R. The molecular mass of GFP fusion RNA increased when the copy number of 2F2R increased. 2F2R or 3F3R was inserted upstream of Alu tandem sequence in pAlu14. Antisense PolyA (PolyAas) was divided into four fragments that all are 60 bp long and the middle two fragments were named 2F2R and 3F3R. PolyA sequences without AATAAA signal in sense or antisense orientation still induced transcription termination. The results showed that all the inserted PolyA sequences partly eliminated the inhibition induced by Alu14.
PolyA and its sequence that was deleted AATAAA signal in sense or antisense orientation were inserted between GFP and Alu tandem sequence in pAlu14. Our results found that Alu tandem sequence inhibited remarkably GFP gene expression, but produced higher-molecular-mass GFP fusion RNA.
Northern blot and fluorescence microscope were used to observe GFP RNA and protein expressions. Fourteen copies of Alu in sense orientation (Alu14) were inserted downstream of GFP in pEGFP-C1 to construct pAlu14 plasmid, and then HeLa cells were transiently transfected with pAlu14. PolyA contains AATAAA hexanucleotide polyadenylation signal. SV40 PolyA (Simian virus 40 PolyA, also called PolyA) sequence is DNA sequence (240 bp) that possesses the activity of transcription termination and can add PolyA tail to mRNA.
0 kommentar(er)
